View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14642_low_62 (Length: 230)
Name: NF14642_low_62
Description: NF14642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14642_low_62 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 48754640 - 48754425
Alignment:
| Q |
1 |
caataaacaaatacaaaatgaaatcgagtcaaaatctcgtcagtcccagctgaaatcctgcagctctcaaatttgtacggctagaacaaaatatcccacc |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48754640 |
caataaacaaataaaaaatgaaatcgagtcaaaatctcgtcagtcccagctgaaatcctgcagctctcaaatttgtacggctagaacaaaatatcccacc |
48754541 |
T |
|
| Q |
101 |
ctctatttattccttcagggtttcaataagggttacccagcaaattcagatacacaggtattgcaatgaaaatctggattaagtttggccaaattaagta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48754540 |
ctctatttattccttcagggtttcaataagggttacccagcaaattcagatacacaggtattgcaatgtaaatctggattaagtttggccaaattaagta |
48754441 |
T |
|
| Q |
201 |
acattgattcacaact |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
48754440 |
acattgattcacaact |
48754425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 52 - 192
Target Start/End: Complemental strand, 49053265 - 49053124
Alignment:
| Q |
52 |
gaaatcctgcagctctcaaatttgtacggctagaacaaaatatccc-accctctatttattccttcagggtttcaataagggttacccagcaaattcaga |
150 |
Q |
| |
|
|||| ||||||| |||| ||||||||| |||||||||||||||||| ||||||||||| ||||||||| || ||||||||||||||||| |||| ||||| |
|
|
| T |
49053265 |
gaaaccctgcaggtctcgaatttgtacagctagaacaaaatatccccaccctctattttttccttcagagtctcaataagggttacccaacaaactcaga |
49053166 |
T |
|
| Q |
151 |
tacacaggtattgcaatgaaaatctggattaagtttggccaa |
192 |
Q |
| |
|
||||||||||||||||| || |||| || |||||||||||| |
|
|
| T |
49053165 |
tacacaggtattgcaatcaatttctgaatcaagtttggccaa |
49053124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 44 - 118
Target Start/End: Complemental strand, 29031700 - 29031626
Alignment:
| Q |
44 |
tcccagctgaaatcctgcagctctcaaatttgtacggctagaacaaaatatcccaccctctatttattccttcag |
118 |
Q |
| |
|
|||||| ||||| ||| |||||||| |||||| || |||||||||||||||| |||||||| || ||||||||| |
|
|
| T |
29031700 |
tcccagatgaaaccctacagctctcgaatttggactgctagaacaaaatatctcaccctcttttctttccttcag |
29031626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University