View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14642_low_69 (Length: 218)
Name: NF14642_low_69
Description: NF14642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14642_low_69 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 24 - 153
Target Start/End: Complemental strand, 32376105 - 32375976
Alignment:
| Q |
24 |
acttgctgctcccatcacgcttggcagaggaggcctcaagtaaatgatttaacctaataataaatggattaagtatgaaactacttaaagaaccatacaa |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32376105 |
acttgctgctcccatcacgcttggcagaggaggcctcaagtaaatgatttaaccttataataaatggattaagtatgaaactacttaaggaaccatacaa |
32376006 |
T |
 |
| Q |
124 |
ttacagtagatttttaccagaactgatgat |
153 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |
|
|
| T |
32376005 |
ttacagtagatttttaccagaactaatgat |
32375976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 89 - 146
Target Start/End: Complemental strand, 32364303 - 32364244
Alignment:
| Q |
89 |
ggattaagtatgaaactacttaaagaacc--atacaattacagtagatttttaccagaac |
146 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||| |||||| ||||||||||| |
|
|
| T |
32364303 |
ggattaagtatgaaactacttatggaaccatatacaattacggtagatatttaccagaac |
32364244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University