View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14642_low_76 (Length: 204)

Name: NF14642_low_76
Description: NF14642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14642_low_76
NF14642_low_76
[»] chr4 (1 HSPs)
chr4 (21-158)||(55383954-55384091)


Alignment Details
Target: chr4 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 21 - 158
Target Start/End: Original strand, 55383954 - 55384091
Alignment:
21 catcatcatttctaaggctcatgtttcatgattgccaagttcaggtaattcctagataggtgttttttatgtcgttcaaggttgcttggacctcactttg 120  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55383954 catcagcatttctaaggctcatgtttcatgattgccaagttcaggtaattcctagataggtgttttttatgtcgttcaaggttgcttggacctcactttg 55384053  T
121 tttgtattaatttgcatgcagggatgtgatgcctcgat 158  Q
    ||||||||||||||||||||||||||||||||||||||    
55384054 tttgtattaatttgcatgcagggatgtgatgcctcgat 55384091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University