View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14642_low_76 (Length: 204)
Name: NF14642_low_76
Description: NF14642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14642_low_76 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 21 - 158
Target Start/End: Original strand, 55383954 - 55384091
Alignment:
| Q |
21 |
catcatcatttctaaggctcatgtttcatgattgccaagttcaggtaattcctagataggtgttttttatgtcgttcaaggttgcttggacctcactttg |
120 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55383954 |
catcagcatttctaaggctcatgtttcatgattgccaagttcaggtaattcctagataggtgttttttatgtcgttcaaggttgcttggacctcactttg |
55384053 |
T |
 |
| Q |
121 |
tttgtattaatttgcatgcagggatgtgatgcctcgat |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55384054 |
tttgtattaatttgcatgcagggatgtgatgcctcgat |
55384091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University