View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14643_high_4 (Length: 342)
Name: NF14643_high_4
Description: NF14643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14643_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 1 - 333
Target Start/End: Original strand, 4004647 - 4004975
Alignment:
| Q |
1 |
tgatatttgaccattagtgcatttcatatttatttcaatatttgaagtctctccttnnnnnnnnnnnnntcaattcaattcagtggatcatatgatttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4004647 |
tgatatttgaccattagtgcatttcatatttatttcaatatttgaagtctctccttaaaaaaccaaaaatcaattcaattcagtggatcatatgatttgt |
4004746 |
T |
 |
| Q |
101 |
ttctaatggatggatggttacaaaataaaactgaaggaaatcatatcatattattttaactgaaggaaaccacgtttcatttgaagtctttaccactacc |
200 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4004747 |
ttctaatggatgg----tcacaaaataaaactgaaggaaatcatatcatattattttaactgaaggaaactacgtttcatttgaagtctttaccactacc |
4004842 |
T |
 |
| Q |
201 |
attgtcaccaaacactctccaccaccacagcactattgctcctcttcactatctacttctattgtattctaatttctatgtatgtttgccatgatttggt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4004843 |
attgtcaccaaacactctccaccaccacagcactattgctcctcttcactatctacttctattgcattctcatttctatgtatgtttgccatgatttggt |
4004942 |
T |
 |
| Q |
301 |
tgaaacatcaaagtgtaatttttgcagaattat |
333 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||| |
|
|
| T |
4004943 |
tgaaacttcaaagtgtaatttttgcaaaattat |
4004975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University