View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14644_high_8 (Length: 328)
Name: NF14644_high_8
Description: NF14644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14644_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 126 - 321
Target Start/End: Complemental strand, 43976003 - 43975795
Alignment:
| Q |
126 |
gcagcttaccgcagcgtagatatgaaaggcaacttactagtagagagatataaaatttcaacaagacatgccacaaaaattgaatgtttgttccataata |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43976003 |
gcagcttaccgcagcgtagatatgaaaggcaacttactagtagagagatataaaatttcaacaagacatgccacaaaaattgaatgtgtgttccataata |
43975904 |
T |
 |
| Q |
226 |
aaaattcagttaaaattacggtttttat------------tttagtctatgaatacctttttgttaggattgcaaatt-aaaaaaccgttacttttcgtt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43975903 |
aaaattcagttaaaattacggtttttattttattttttattttagtctatgaatacctttttgttaggattgcaaattaaaaaaaccgttacttttcgtt |
43975804 |
T |
 |
| Q |
313 |
gatgatgtc |
321 |
Q |
| |
|
|||||||| |
|
|
| T |
43975803 |
catgatgtc |
43975795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University