View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14644_low_10 (Length: 328)

Name: NF14644_low_10
Description: NF14644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14644_low_10
NF14644_low_10
[»] chr7 (1 HSPs)
chr7 (126-321)||(43975795-43976003)


Alignment Details
Target: chr7 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 126 - 321
Target Start/End: Complemental strand, 43976003 - 43975795
Alignment:
126 gcagcttaccgcagcgtagatatgaaaggcaacttactagtagagagatataaaatttcaacaagacatgccacaaaaattgaatgtttgttccataata 225  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
43976003 gcagcttaccgcagcgtagatatgaaaggcaacttactagtagagagatataaaatttcaacaagacatgccacaaaaattgaatgtgtgttccataata 43975904  T
226 aaaattcagttaaaattacggtttttat------------tttagtctatgaatacctttttgttaggattgcaaatt-aaaaaaccgttacttttcgtt 312  Q
    ||||||||||||||||||||||||||||            |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
43975903 aaaattcagttaaaattacggtttttattttattttttattttagtctatgaatacctttttgttaggattgcaaattaaaaaaaccgttacttttcgtt 43975804  T
313 gatgatgtc 321  Q
     ||||||||    
43975803 catgatgtc 43975795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University