View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14644_low_15 (Length: 251)
Name: NF14644_low_15
Description: NF14644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14644_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 34301809 - 34301623
Alignment:
| Q |
1 |
tggaaaatttgctattaaagagagaacgaaaagctgagactatattgtcaaattcagaaatgtcttctcgtctctgggagaagcccttggatgtgtgtat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34301809 |
tggaaaatttgctattaaagagagaacgagaagctgagactatattgtcaaattcagaaatgtcttctcgtctctgggagaagcccttggatgtgtgtat |
34301710 |
T |
 |
| Q |
101 |
ctttaatgatttaaatttatgaaaagaaactcagcctaaataaaactatccgttaataaagttagctaatgattgggctctgccctc |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34301709 |
ctttaatgatttaaatttatgaaaagaaactcagcctaaataaaactatccgttaataaagttagctaatggttgggctctgccctc |
34301623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 208 - 241
Target Start/End: Complemental strand, 34301601 - 34301568
Alignment:
| Q |
208 |
gttagctaatggttataactcttatttacctttg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34301601 |
gttagctaatggttataactcttatttacctttg |
34301568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 4 - 69
Target Start/End: Original strand, 30622639 - 30622704
Alignment:
| Q |
4 |
aaaatttgctattaaagagagaacgaaaagctgagactatattgtcaaattcagaaatgtcttctc |
69 |
Q |
| |
|
|||||||| ||||||||||||| ||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30622639 |
aaaatttgatattaaagagagagcgagaagctgagactatattgccaaattcagaaatgtcttctc |
30622704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University