View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14645_high_5 (Length: 209)
Name: NF14645_high_5
Description: NF14645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14645_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 32430509 - 32430328
Alignment:
| Q |
1 |
atcgaatgcataaccgttaaatataattgggtaagccactttggacttgttcgtgtgtaaaatattataccaaataaataaacaagtttattggcctcat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32430509 |
atcgaatgcataaccgttaaatataattgtgtaagccactttggacttgtttgtgtgtaaaatattataccaaataaataaacaagcttattggcctcat |
32430410 |
T |
 |
| Q |
101 |
gtttcttctttttgtgtgaagccatcttcctcatgagcagctgcaaagaaaatggaggaattgacttgtggaaggtatttgc |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32430409 |
gtttcttctttttgtgtgaagccatcttcctcatgagcagctgcaaagaaaatggaggaattgacttgtggaaggtatttgc |
32430328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University