View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14645_low_3 (Length: 289)
Name: NF14645_low_3
Description: NF14645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14645_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 229 - 274
Target Start/End: Complemental strand, 22792691 - 22792646
Alignment:
| Q |
229 |
gtttaatggaatgtttggtcccatatgtttattttaggtttcaagt |
274 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22792691 |
gtttaattgtatgtttggtcccatatgtttattttaggttttaagt |
22792646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 239 - 274
Target Start/End: Complemental strand, 48171840 - 48171805
Alignment:
| Q |
239 |
atgtttggtcccatatgtttattttaggtttcaagt |
274 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48171840 |
atgtttggtcccttatgtttattttaggtttcaagt |
48171805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 239 - 274
Target Start/End: Complemental strand, 43971917 - 43971882
Alignment:
| Q |
239 |
atgtttggtcccatatgtttattttaggtttcaagt |
274 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43971917 |
atgtttggtcccttatgtttattttaggtttcaagt |
43971882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 274
Target Start/End: Complemental strand, 3016095 - 3016050
Alignment:
| Q |
229 |
gtttaatggaatgtttggtcccatatgtttattttaggtttcaagt |
274 |
Q |
| |
|
||||||| | |||||||||||| || |||||||||||||||||||| |
|
|
| T |
3016095 |
gtttaattgcatgtttggtcccttaagtttattttaggtttcaagt |
3016050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 239 - 271
Target Start/End: Complemental strand, 18935452 - 18935420
Alignment:
| Q |
239 |
atgtttggtcccatatgtttattttaggtttca |
271 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
18935452 |
atgtttggtcccttatgtttattttaggtttca |
18935420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University