View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14645_low_4 (Length: 267)
Name: NF14645_low_4
Description: NF14645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14645_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 65 - 252
Target Start/End: Original strand, 17593298 - 17593484
Alignment:
| Q |
65 |
acttgattttcctgaagcattttgttgattgtagtagtaagtgagttcatagaggttacttgtgcaggaagttagataactatcttaactgtttgttaac |
164 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17593298 |
acttaattttcctgaagcattttgttgattgtagtagtaagtgagttcatagaggttacttgtgcaggaagttagataactatcttaactgtttgttaac |
17593397 |
T |
 |
| Q |
165 |
aattttctagctagagttactatctatttcaactagagttagttagagtatttagattgtagaaaactataaatgtgtgcaaaacact |
252 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17593398 |
aattttctagcttgagttactatctatttcaactagagttagttagagtatttagattgtag-aaactataaatgtgtgcaaaacact |
17593484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 17593340 - 17593303
Alignment:
| Q |
1 |
cacttactactacaatcaccaaaatgcttcaggaaaat |
38 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17593340 |
cacttactactacaatcaacaaaatgcttcaggaaaat |
17593303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 37 - 68
Target Start/End: Original strand, 17584403 - 17584434
Alignment:
| Q |
37 |
atcaagctgctgaattcttgtttctcacactt |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
17584403 |
atcaagctgctgaattcttgtttctcacactt |
17584434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 37 - 68
Target Start/End: Original strand, 17593195 - 17593226
Alignment:
| Q |
37 |
atcaagctgctgaattcttgtttctcacactt |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
17593195 |
atcaagctgctgaattcttgtttctcacactt |
17593226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University