View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14645_low_6 (Length: 236)
Name: NF14645_low_6
Description: NF14645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14645_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 107 - 218
Target Start/End: Original strand, 28484777 - 28484888
Alignment:
| Q |
107 |
tcaggaacaccaggggaaaaagaagagaaagtttctttggatctcagtgaagaaattcttctcagtatggaagttggaatgtccttcaaagattacgtaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28484777 |
tcaggaacaccaggggaaaaagaagagaaagtttctttggatctcagtgaagaaattcttctcagtatggaagttggaatgtccttcaaagattacgtaa |
28484876 |
T |
 |
| Q |
207 |
ccaatttctact |
218 |
Q |
| |
|
|||||||||||| |
|
|
| T |
28484877 |
ccaatttctact |
28484888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 28484671 - 28484709
Alignment:
| Q |
1 |
catcttcaacaatgggtggtacaccaaaattatcactac |
39 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28484671 |
catcttcaacaatgggtggtacacctaaattatcactac |
28484709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University