View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14646_high_17 (Length: 216)
Name: NF14646_high_17
Description: NF14646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14646_high_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 41 - 201
Target Start/End: Complemental strand, 10141960 - 10141800
Alignment:
| Q |
41 |
aaatatgtttgaaatagctcaatatttgattatttcatgttttaatttaaacttaatatgctaataattttttagttgcatcttatttaggatcattggt |
140 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10141960 |
aaatatgtttgaaatagcttaatatttgattatttcatgttttaatttaaacttaatatgctaataattttctagttgcatcttatttaggatcattggt |
10141861 |
T |
|
| Q |
141 |
taaataataggatattgtcgtggtttgtgagagggtagtgttagtgcagtgcattcttttc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10141860 |
taaataataggatattgtcgtggtttgtgagagggtagtgttagtgcagtgcattcttttc |
10141800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 24 - 69
Target Start/End: Complemental strand, 10142019 - 10141974
Alignment:
| Q |
24 |
tattttgtcaaaacataaaatatgtttgaaatagctcaatatttga |
69 |
Q |
| |
|
|||| ||||||||||||||||||||| || |||||| ||||||||| |
|
|
| T |
10142019 |
tattatgtcaaaacataaaatatgttcgagatagctaaatatttga |
10141974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University