View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14646_high_6 (Length: 388)
Name: NF14646_high_6
Description: NF14646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14646_high_6 |
 |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0019 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 30 - 382
Target Start/End: Complemental strand, 141386 - 141035
Alignment:
| Q |
30 |
aataaggtataaactgttgctggaaagaaaggggtatgcattcttttgtggatgttgaatacgagaatttacctgattattgcacgaattgtaagtcatt |
129 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
141386 |
aataaggtataaactgtttgtggaaagaaaggggtatgcattcttt-gtggatgttgaatacgagaatttacctgattattgcacgaattgtaagtcatt |
141288 |
T |
 |
| Q |
130 |
aagacattatgtggagatttgcaaaaaactaaactgtgaagaggctgatgtcccgatgaaagagacaactgcgaagatggatgcagaaaataagaggaaa |
229 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
141287 |
agcacattatgtggagatttgcaaaaaactaaactgtgaagaggttgatgtcccgatgaaagagacaactgcgaagatggatgcagaaaataagaggaaa |
141188 |
T |
 |
| Q |
230 |
catggtaaaaatcctaaaccagtatatgtacaaactagggatggcagaggaattcaggggaaggctcaaaatgaagtagctgaaggtgcacatgttgttg |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
141187 |
catggtaaaaatcctaaaccagtatatgtacaaaccagggatggcagaggtattcaggggaaggctcaaaatgaagtagctgaaggcgcacatgttgcta |
141088 |
T |
 |
| Q |
330 |
atgcacctgaaacgccagatgagaggctgcaaagagagattgatgcagtatta |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
141087 |
atgcacctgaaacgccagatgagaggctgcaaagagagattgatgcagaatta |
141035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University