View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14646_low_14 (Length: 284)
Name: NF14646_low_14
Description: NF14646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14646_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 7e-89; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 19 - 279
Target Start/End: Original strand, 10905818 - 10906093
Alignment:
| Q |
19 |
ggaggaaaaccatgcttgaagtagcatgtgtcaactgtcaagatcacggttggtgccattacaatgtgttcatgttt---------------tgtctcgc |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10905818 |
ggaggaaaaccatgcttgaagtagcatgtgtcaactgtcaagatcacggttggtgccattacaatgtgttcatgtttaaaagacccttagcttgtctcgc |
10905917 |
T |
 |
| Q |
104 |
aagaaacgacttgaaattgggcttgatgtgacatgaaagtcttgcttgccttgnnnnnnnnnnnnnnnnggattaccatgttataggtacggagtttcca |
203 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10905918 |
aagaaacgacttgaaattgggcttgacgtgacatgaaagtcttgcttgccttgttttttgttttgttttggattaccatgttataggtacggagtttcca |
10906017 |
T |
 |
| Q |
204 |
tcaccgtttaatgatgactaatctccatcggaaaataacccttgctgtttaaatagcaagagtggtgagttcatat |
279 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10906018 |
tcaccgtttaatgatgactaatctccgtcggaaaataacccttgctgtataaatagcaagagtggtgagttcatat |
10906093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 52
Target Start/End: Original strand, 10860776 - 10860809
Alignment:
| Q |
19 |
ggaggaaaaccatgcttgaagtagcatgtgtcaa |
52 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
10860776 |
ggaggaaaaccatgcttgaagtagcatgtatcaa |
10860809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University