View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14647_low_4 (Length: 277)
Name: NF14647_low_4
Description: NF14647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14647_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 32 - 259
Target Start/End: Complemental strand, 22124597 - 22124352
Alignment:
| Q |
32 |
ctatgttatagataacaatttaaacacttgtatcacataaggtattatcacaaaataagattaatgacaagcatagtaattgcaactagggaaaggccat |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22124597 |
ctatgttatagataacaatttaaacacttgtatcacataaggtattatcacaaaataagattaatgacaagcatagtaattgcaactagggaaaggccat |
22124498 |
T |
|
| Q |
132 |
gattgacagtatttgcccaagcacctgaaggaggtggaggtggagttgga------------------ggtgcagcgggagtattaatattagtcaccgc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| || |||||||||||| |
|
|
| T |
22124497 |
gattgacagtatttgcccaagcacctgaaggaggtggaggtggagttggaggtggtggtgcaggtgcaggtgcagcgggagtatcaacattagtcaccgc |
22124398 |
T |
|
| Q |
214 |
gggaagaggtgggtcaacaacgtttgcaacctcaagaggtggaagt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22124397 |
gggaagaggtgggtcaacaacgtttgcaacctcaagaggtggaagt |
22124352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University