View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14648_high_3 (Length: 326)
Name: NF14648_high_3
Description: NF14648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14648_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 18 - 318
Target Start/End: Complemental strand, 47666434 - 47666134
Alignment:
| Q |
18 |
atcatggcgtcaaggaagacctctcccttattttccgcggtgtcgccaacttcctcgctccacctccttcatcatcttcttcttccgcttcctctggtga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47666434 |
atcatggcgtcaaggaagacctctcccttattttccgcggtgtcgccaacttcctcgctccacctccttcatcatcttcttcttccgcttcctctggtga |
47666335 |
T |
 |
| Q |
118 |
gtcaacctcaccttcaaaaactctcaccggaatccgcaacgatctcgtcgaaatcggtggaagcttcaagagctcactctctcttctctccccaagaaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47666334 |
gtcaacctcaccttcaaaaactctcaccggaatccgcaacgatctcgtcgaaatcggtggaagcttcaagagctcactctctcttctctccccaagaaaa |
47666235 |
T |
 |
| Q |
218 |
gccgtcaccggaatttcaaagcttgcttctcaattgttgcagtcagagcgtgatcatgaagaagatgatgacggtgcggtgcctggaacaactgatgatg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47666234 |
gccgtcaccggaatttcaaagcttgcttctcaattgttgcagtcagagcgtgatcatgaagaagatgatgacggtgcggtgcctggaacaactgatgatg |
47666135 |
T |
 |
| Q |
318 |
t |
318 |
Q |
| |
|
| |
|
|
| T |
47666134 |
t |
47666134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University