View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14648_low_3 (Length: 407)
Name: NF14648_low_3
Description: NF14648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14648_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 216 - 389
Target Start/End: Original strand, 4499382 - 4499555
Alignment:
| Q |
216 |
gcaattatgttgcaagttatggtgatgaaaaaatggggtgctgttcataattggtttggtcaaaataaaaaccaaattaatgggatggtaatgannnnnn |
315 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4499382 |
gcaattatgttgcaagttattgtgatgaaaaaatggggtgctgttcataattggtttggtcaaaataaaaaccaaattaatgggatggtaatgatttttt |
4499481 |
T |
 |
| Q |
316 |
natacaacttgctaacatggaaataagattatgcatgtttcttacagattttttcatcaattgagagcagtttc |
389 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4499482 |
tatacaacttgctaacatggaaataagattatgcatgtttcttacagattttttcatcaatttagagcagtttc |
4499555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 243 - 309
Target Start/End: Complemental strand, 13233719 - 13233653
Alignment:
| Q |
243 |
aaaaaatggggtgctgttcataattggtttggtcaaaataaaaaccaaattaatgggatggtaatga |
309 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||| |||||||||| || |||| |||||||| |
|
|
| T |
13233719 |
aaaaaatggggtgatgttcataattggttcagtcaaaacgaaaaccaaataaacgggacggtaatga |
13233653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University