View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14648_low_3 (Length: 407)

Name: NF14648_low_3
Description: NF14648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14648_low_3
NF14648_low_3
[»] chr7 (1 HSPs)
chr7 (216-389)||(4499382-4499555)
[»] chr1 (1 HSPs)
chr1 (243-309)||(13233653-13233719)


Alignment Details
Target: chr7 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 216 - 389
Target Start/End: Original strand, 4499382 - 4499555
Alignment:
216 gcaattatgttgcaagttatggtgatgaaaaaatggggtgctgttcataattggtttggtcaaaataaaaaccaaattaatgggatggtaatgannnnnn 315  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          
4499382 gcaattatgttgcaagttattgtgatgaaaaaatggggtgctgttcataattggtttggtcaaaataaaaaccaaattaatgggatggtaatgatttttt 4499481  T
316 natacaacttgctaacatggaaataagattatgcatgtttcttacagattttttcatcaattgagagcagtttc 389  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
4499482 tatacaacttgctaacatggaaataagattatgcatgtttcttacagattttttcatcaatttagagcagtttc 4499555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 243 - 309
Target Start/End: Complemental strand, 13233719 - 13233653
Alignment:
243 aaaaaatggggtgctgttcataattggtttggtcaaaataaaaaccaaattaatgggatggtaatga 309  Q
    ||||||||||||| |||||||||||||||  |||||||  |||||||||| || |||| ||||||||    
13233719 aaaaaatggggtgatgttcataattggttcagtcaaaacgaaaaccaaataaacgggacggtaatga 13233653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University