View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14649_high_20 (Length: 408)
Name: NF14649_high_20
Description: NF14649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14649_high_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 8e-71; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 247 - 394
Target Start/End: Original strand, 35437321 - 35437468
Alignment:
| Q |
247 |
agtcacttcaacggctaattttatcgaatatttaaatttttgtccaacagaccccttgtatatatggcggaaattctaagtttgctagtgaatcaaatgt |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
35437321 |
agtcacttcaacggctaattttatcgaatatttaaatttttgtccaacaaaccccttatatatatggcggaaattctaagtttgctagtgaatcaaattt |
35437420 |
T |
|
| Q |
347 |
ttcgttttttattcttattgttaatcgttagaactttctttcgatgat |
394 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35437421 |
ttcgttttttattcttattgttaatcgttagaactttctttcgatgat |
35437468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 116 - 183
Target Start/End: Original strand, 35437191 - 35437257
Alignment:
| Q |
116 |
tatcaattgaattcatatatcacatatcattgtaacgatgaaaatgtagtttaaaattaattaaaaag |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| ||||||||||| |
|
|
| T |
35437191 |
tatcaattgaattcatatatcacatatcattgtaacgatgaaaatgta-ttttaaagtaattaaaaag |
35437257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 35437075 - 35437127
Alignment:
| Q |
1 |
gatttttgatttgactctctgatgtgtcaattttgattggctggtttaacttc |
53 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
35437075 |
gatttttggtttgactctcagatgtgtcaattttgattgactggtttaacttc |
35437127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University