View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14649_high_24 (Length: 366)
Name: NF14649_high_24
Description: NF14649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14649_high_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 148 - 350
Target Start/End: Original strand, 31658583 - 31658785
Alignment:
| Q |
148 |
ccaatgccaaactttgaaaataaatttacacttagacagaaacatatccatagccatcaaaatcctaactggtcataaacattctcaaattcaaatgatt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31658583 |
ccaatgccaaactttgaaaataaatttacacttagacagaaacatatccatagccatcaaaatcctaactggtcataaacattctcaaattcaaatgatt |
31658682 |
T |
|
| Q |
248 |
caatcgatgatagcatagtggcatgtctcaaataatcaaaacaaaattcaaagttacatgatatgaggttatctgatgagaacaattgattttgagaaga |
347 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31658683 |
caatcgatgatagcatagtggcacgtctcaaataatcaaaataaacttcaaagttacatgatatgaggttatctgatgagaacaattgattttgagaaga |
31658782 |
T |
|
| Q |
348 |
ata |
350 |
Q |
| |
|
||| |
|
|
| T |
31658783 |
ata |
31658785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 9 - 46
Target Start/End: Original strand, 31658521 - 31658558
Alignment:
| Q |
9 |
gacatcatcagttaaacgatcaaataaatctcccatta |
46 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31658521 |
gacatcataagttaaacgatcaaataaatctcccatta |
31658558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University