View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14649_high_27 (Length: 363)
Name: NF14649_high_27
Description: NF14649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14649_high_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 19 - 348
Target Start/End: Complemental strand, 18133428 - 18133099
Alignment:
| Q |
19 |
ggtaggtaaattctcagtatcaggacgagaaagaacacggagagttaggttaaccatttgaagatctttggtgccagagattgaagagaatgtgtgggga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18133428 |
ggtaggtaaattctcagtatcaggacgagaaagaacacggagagttaggttaaccatttgaagatctttggtgccagagattgaagagaatgtgtgggga |
18133329 |
T |
|
| Q |
119 |
cgagttttgatatcgaagatgtaaggcttttgaacccatgggatgaggaaatgggttccttcaccgattgattggtcgaggattccgcgaaaacggtcga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18133328 |
cgagttttgatatcgaagatgtaaggcttttgaacccatgggatgaggaaatgggttccttcaccgattgattggtcgaggattccgcgaaaacggtcga |
18133229 |
T |
|
| Q |
219 |
agaggacggcgcgttggccaccatcgacggtgtagagggaggtgttgacaacggttgcggcggtgccgaggccgaaagcggcacgggcgaggttggttag |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18133228 |
agaggacggcgcgttggccaccatcgacggtgtagagggaggtgttgacaacggttgcggcggtgccgaggccgaaagcggcacgggcgaggttggttag |
18133129 |
T |
|
| Q |
319 |
gaaggagactgcggcttggttgctgcccat |
348 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |
|
|
| T |
18133128 |
gaaggagactgcggcttggttgcttcccat |
18133099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 127; Significance: 2e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 32 - 294
Target Start/End: Original strand, 1385068 - 1385330
Alignment:
| Q |
32 |
tcagtatcaggacgagaaagaacacggagagttaggttaaccatttgaagatctttggtgccagagattgaagagaatgtgtggggacgagttttgatat |
131 |
Q |
| |
|
||||||||||||||||| |||||||| ||||| || || ||||| |||||||||||||| || ||||| || ||||||||||| || ||||| ||||| |
|
|
| T |
1385068 |
tcagtatcaggacgagagagaacacgaagagtgagattcaccatctgaagatctttggtaccggagatggatgagaatgtgtgaggtcgagtgcggatat |
1385167 |
T |
|
| Q |
132 |
cgaagatgtaaggcttttgaacccatgggatgaggaaatgggttccttcaccgattgattggtcgaggattccgcgaaaacggtcgaagaggacggcgcg |
231 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| ||||||||||||| ||||| | ||||| ||||| || | ||| |||||||||||||| |
|
|
| T |
1385168 |
cgaagacgtaaggcttttgaacccatgggatgaggaaatgagttccttcaccgactgattcggaaaggatgccgcggaatctgtcaaagaggacggcgcg |
1385267 |
T |
|
| Q |
232 |
ttggccaccatcgacggtgtagagggaggtgttgacaacggttgcggcggtgccgaggccgaa |
294 |
Q |
| |
|
||||||||| |||||||||||||| |||| |||||| |||||||||||| |||||| ||||| |
|
|
| T |
1385268 |
ttggccaccgtcgacggtgtagagagaggagttgacggcggttgcggcggcgccgagaccgaa |
1385330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 134 - 183
Target Start/End: Complemental strand, 40614842 - 40614793
Alignment:
| Q |
134 |
aagatgtaaggcttttgaacccatgggatgaggaaatgggttccttcacc |
183 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
40614842 |
aagatgtagggcttttgaacccatgggatcaggaaatgagttccttcacc |
40614793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University