View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14649_high_37 (Length: 285)
Name: NF14649_high_37
Description: NF14649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14649_high_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 13 - 261
Target Start/End: Complemental strand, 54082852 - 54082602
Alignment:
| Q |
13 |
attatactttgaaggtaa-tagattgagagcctttgttgaagcgagagagaccatcctagcgttacatgatgtgagtatgagtcccatgcttgtttggaa |
111 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
54082852 |
attatactttgaaggtaaatagattgagagcctttgttgaagcgagagagacgatcctagcgttacatgatgtgagtgtgagtcccatgcttgtttggaa |
54082753 |
T |
|
| Q |
112 |
gtttgttcacttccaagtagagtgataacattctgatccatggatgagagaatgacatgaaaaacaagttgatcttgccttct-caatattaatagtctc |
210 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
54082752 |
gtttgttcactgccaagtagagtgataacattctgatccatggatgagagaatgacatgaaaaacaagttgatcttgccttctccaatattcatagtctc |
54082653 |
T |
|
| Q |
211 |
catgagtttggctgaacattgagattgagttgcggcatcaacaaatttgag |
261 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
54082652 |
catgagtttggctggacattgagattgagttgcggcatcaacaaatttgag |
54082602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 93 - 192
Target Start/End: Complemental strand, 9008627 - 9008528
Alignment:
| Q |
93 |
gtcccatgcttgtttggaagtttgttcacttccaagtagagtgataacattctgatccatggatgagagaatgacatgaaaaacaagttgatcttgcctt |
192 |
Q |
| |
|
|||||||||||||||||| ||| | |||| ||||| | |||| |||||||||||||||||| ||||||||| |||||| | ||||||||||||||| |
|
|
| T |
9008627 |
gtcccatgcttgtttggagttttttgcactaccaagcattgtgacaacattctgatccatggaggagagaatggcatgaagtatgagttgatcttgcctt |
9008528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University