View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14649_high_40 (Length: 276)
Name: NF14649_high_40
Description: NF14649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14649_high_40 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 132 - 260
Target Start/End: Complemental strand, 33717050 - 33716922
Alignment:
| Q |
132 |
cagtgaggggtgatttcatgcaaannnnnnngccaaaaaccaaccaatgacacaaaaaggagaaaaagaattgacagaaggtgagtggtggataactcta |
231 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33717050 |
cagtgaggggtgatttcatgcaattttttttgccaaaaaccaaccaatgacacaaaaaggagaaaaagaattgacagaaggtgagaggtggataactcta |
33716951 |
T |
 |
| Q |
232 |
attttcgtcttaagtctcttatgcattga |
260 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33716950 |
attttcgtcttaagtctcttatgcattga |
33716922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 40 - 72
Target Start/End: Complemental strand, 33717105 - 33717073
Alignment:
| Q |
40 |
gaagaagcaaatatttgttgataaccacttatt |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33717105 |
gaagaagcaaatatttgttgataaccacttatt |
33717073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University