View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14649_high_47 (Length: 248)
Name: NF14649_high_47
Description: NF14649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14649_high_47 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 36445373 - 36445144
Alignment:
| Q |
1 |
ttatcaatgatatgagttcactttgcttttgttaaataaaaagtaggaaaaagtcgctttcaaatgagcctatatccttgtagtgagaatgcatgcataa |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36445373 |
ttattaatgatatgagttcactttgcttttgttaaataaaaagtaggaaaaagtcgctttcaaatgagcctatatccttgtagtgagaatgcatgcataa |
36445274 |
T |
|
| Q |
101 |
gaggcgttaattaacaaggaatttacgtgttacggtgtcaaaaaggaagaacnnnnnnnttacatggaagtactaaagaagtaccacattccattcttgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
36445273 |
gaggcgttaattaacaaggaatttacgtgttatggtgtcaaaaaggaagaacaaaaaaattacatggaagtactaaagaagtaccacattcctttgttga |
36445174 |
T |
|
| Q |
201 |
tattaatgaaccgtaagtagtaggtcatga |
230 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36445173 |
aattaatgaaccgtaagtagtaggtcatga |
36445144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University