View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14649_high_53 (Length: 239)
Name: NF14649_high_53
Description: NF14649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14649_high_53 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 44039420 - 44039188
Alignment:
| Q |
1 |
caaaacaaagagggagaagtgaattacacaccatattcgaaacttggtgatctcaaattaaactgttgatacaaggattgcttggttgctagaaaatgtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44039420 |
caaaacaaagagggagaagtgaattacacaccatattcgaaacttggtgatctcaaattcaactgttgatacaaggattgcttggttgctagaaaatgtg |
44039321 |
T |
 |
| Q |
101 |
annnnnnnnnn--ataaatgctagaagagatgttgaagatggtatgatattgggtcggagtatttttgtttatatagttaaggatacttcatagttaaga |
198 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44039320 |
attttttttttttataaatgctagaagagatgttgaagatggtatgatattgggtcggagtatttttgtttatatagttaaggatacttcatagttaaga |
44039221 |
T |
 |
| Q |
199 |
aatggaattccttatgatccagg-tgatgatgt |
230 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
44039220 |
aatggaattccttatgatccaggatgatgatgt |
44039188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University