View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14649_high_60 (Length: 231)
Name: NF14649_high_60
Description: NF14649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14649_high_60 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 20 - 221
Target Start/End: Complemental strand, 41444439 - 41444237
Alignment:
| Q |
20 |
ggagagtcagtgtagtatactttgacttaagcctgctagaaagaagcttaaaactgtttatctctttctccccttattaattcttccatcttcagaactg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41444439 |
ggagagtcagtgtagtatactttgacttaagcctgctagaaagaagcttaaaactgtttatctctttctccccttattaattcttccatcttcagaactg |
41444340 |
T |
|
| Q |
120 |
tatagt-nnnnnnnnntattcctatctctcttttgcaaatctacataattctaccaaaacaaaggcagtgaggcagtgtgttgggtatggctcacaggtt |
218 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
41444339 |
tatagtaaaaaaaaaatattcctatctctcttttgcaaatctacataattctaccaaaacaaaggaagtgaggcagtgtgttgggtatggctcataggtt |
41444240 |
T |
|
| Q |
219 |
ctg |
221 |
Q |
| |
|
||| |
|
|
| T |
41444239 |
ctg |
41444237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University