View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14649_high_68 (Length: 221)
Name: NF14649_high_68
Description: NF14649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14649_high_68 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 3 - 210
Target Start/End: Complemental strand, 46915005 - 46914803
Alignment:
| Q |
3 |
ctacctccactgccctatgttttgttctattttgggatgagccaaacttgattctcattgtgtagaattgattgatatgtttgaatgttttgggtagaat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46915005 |
ctacctccactgccctatgttttgttctattttgggatgagccaaacttgattctcattgtgtagaattgattgatatgtttgaatgttttgggtagaat |
46914906 |
T |
|
| Q |
103 |
tcaagagcatatagttgaaagcaaaatctccaaattaaatttacatcattgcttgggtttatgtaaagagttggtaacttttattttcttacttttttaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46914905 |
tcaagagcatatagttgaaagcaaaatctcca-----aatttacatcattgcttgggtttatgtaaagagttggtaacttttattttcttacttttttaa |
46914811 |
T |
|
| Q |
203 |
cctttgct |
210 |
Q |
| |
|
|| ||||| |
|
|
| T |
46914810 |
cccttgct |
46914803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University