View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14649_high_75 (Length: 207)
Name: NF14649_high_75
Description: NF14649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14649_high_75 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 19 - 192
Target Start/End: Complemental strand, 10810753 - 10810580
Alignment:
| Q |
19 |
ataatcacaacaatagcctttcccaaatggaaaattccccttttcatccttcttcatcatcatttccatgtcttcctcaacccctttttctccaccacca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10810753 |
ataatcacaacaatagcctttcccaaatggaaaattccctttttcttccttcttcatcatcatttccatgtcttcctcaacccctttttctccaccacca |
10810654 |
T |
|
| Q |
119 |
caaatcccttacctcaccaaccttggctttggctactccatagccatagctcttggcttcctcttccttctttc |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10810653 |
caaatcccttacctcaccaaccttggctttggctactccatagccatagctcttggcttcctcttccttctttc |
10810580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 166
Target Start/End: Complemental strand, 30078255 - 30078221
Alignment:
| Q |
132 |
tcaccaaccttggctttggctactccatagccata |
166 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
30078255 |
tcaccaaccttggccttggctactccatagccata |
30078221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University