View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14649_low_27 (Length: 365)
Name: NF14649_low_27
Description: NF14649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14649_low_27 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 300; Significance: 1e-168; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 1 - 356
Target Start/End: Complemental strand, 3803 - 3450
Alignment:
| Q |
1 |
tcgaatctcactacaacggatattgatggcaccagtctgcattggacaactttctttggaaagatcggaacctacttatattttatggaaaatcatatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |||| |
|
|
| T |
3803 |
tcgaatctcactacaacggatattgatggcaccagtctgcattggacaactttctttggaaagaccggaacctacttatattttatggcaaatcaaatct |
3704 |
T |
 |
| Q |
101 |
tagtacaaatccccacaatatagtggatagttttgttcgtcattaatacaattggtaccattaactttaattcttacttcgaaaaatccaaagaaagaat |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
3703 |
tagtacaaatccccacaatatagtcgatagttttgttcgtcattaatacaattggtaccattaactttaattcttacttc-aaaaatctaaagaaagaat |
3605 |
T |
 |
| Q |
201 |
ttcacattttttggaaacctcctcgcgataattgtttgaagtttgttattgatagctctcatcgaactgttgataatcaactgcttttggtgtgttaatt |
300 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3604 |
ttcacattttttggaaacct-ctcgcgataattgtttgaagtttgttattgacagctctcatcaaactgttgataatcaactgcttttggtgtgttaatt |
3506 |
T |
 |
| Q |
301 |
agagacttcacaggttgtttgactaaaggatttcattgaaatttaggaaccgctat |
356 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
3505 |
agagactttacaggttgtttgactaagggatttcattgaaatttaggaacctctat |
3450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University