View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14649_low_32 (Length: 349)
Name: NF14649_low_32
Description: NF14649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14649_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 20 - 320
Target Start/End: Original strand, 44737573 - 44737875
Alignment:
| Q |
20 |
atgaaagcgtgcatatgaagaggggagtaatcgaggtgaatgtggggtatctagcagacaaaaacgtgtgttggagctgagcttctttctcttcaaccgt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44737573 |
atgaaagcgtgcatatgaagaggggagtaatcgaggtgaatgtggggtatctagcagacaaaaacgtgtgttggagctgagcttctttctcttcaaccgt |
44737672 |
T |
|
| Q |
120 |
cccttattcgcatggcgtgcgcctcacctttacaactacaacatgtcatggtgcgctgctgtgcggccttcagccctcattcccatacgacaactgcctg |
219 |
Q |
| |
|
| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44737673 |
ctcttattcgcatggcgtgcgtctcacctttacaactacaacatgtcatggtgcgctgctgtgcggccttcagccctcattcccacacgacaactgcctg |
44737772 |
T |
|
| Q |
220 |
tacccggttacttgtcagtcaccccacacccattccacatccttccttactttattctatccatttccataaca--ttttgaaatattcatcatgcttac |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44737773 |
tacccggttacttgtcagtcaccccacacccattccacacccttccttactttattctatccatttccataacatgttttgaaatattcatcatgcttac |
44737872 |
T |
|
| Q |
318 |
ttt |
320 |
Q |
| |
|
||| |
|
|
| T |
44737873 |
ttt |
44737875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University