View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14649_low_40 (Length: 294)
Name: NF14649_low_40
Description: NF14649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14649_low_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 14 - 276
Target Start/End: Original strand, 42897431 - 42897693
Alignment:
| Q |
14 |
attcttcaggaaacaaaactcatgaagttgatgccaaattctctcagcaatactttgcttcatcacaaactcaaactcatgatgaaactccagctaagaa |
113 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42897431 |
attcttcaggaaacagaactcatgaagttgatgccaaattctctcagcaatactttgcttcatcacaaactcaaactcatgatgaaactccagctaagaa |
42897530 |
T |
|
| Q |
114 |
aagaagaaaccttcctggcaatccaggttcattttcttaagttctaccatcttttgttttcatcttaattgttataaattgcggatatagtcgcggttat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42897531 |
aagaagaaaccttcctggcaatccaggttcattttcttaagttctaccatcttttgttttcatcttaattgttataaattgcggatatagttgcggttat |
42897630 |
T |
|
| Q |
214 |
gattacgctatgaaccatgatattgtggtaaaatatggaggcaaatatggtcgatgcagcggc |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42897631 |
gattacgctatgaaccatgatattgtggtaaaatatggaggcaaatatggtcgatgcagcggc |
42897693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University