View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14649_low_42 (Length: 284)
Name: NF14649_low_42
Description: NF14649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14649_low_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 13 - 268
Target Start/End: Original strand, 46454535 - 46454790
Alignment:
| Q |
13 |
caagaatatgaggatttacccgaaaactatgtagatacctataaaacagatttaaaatttcctaatcctaatctcaaaagtgcttacatagcactacaag |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46454535 |
caagaaaatgaggatttacccgaaaactatgtagatacctataaaacagatttaaaatttcctaatcctaatctcaaaagtgcttacatagcactacaag |
46454634 |
T |
|
| Q |
113 |
catggaaaaaagcaatttattcagacccaaccaacttcacatcaaattgggagggccctaatgtttgttcttacaatggaattttttgtgcagcttctct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46454635 |
catggaaaaaagcaatttattcagacccaaccaacttcacatcaaattgggagggccctaatgtttgttcttacaatggaattttttgtgcagcttctct |
46454734 |
T |
|
| Q |
213 |
taatgattcaaaaattcaagttgtagctgggattgatcttaatcaagcagacattg |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46454735 |
taatgattcaaaaattcaagttgtagctgggattgatcttaatcaagcagacattg |
46454790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University