View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14649_low_49 (Length: 250)
Name: NF14649_low_49
Description: NF14649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14649_low_49 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 3e-60; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 18 - 143
Target Start/End: Original strand, 10527296 - 10527421
Alignment:
| Q |
18 |
atgcttacaaaatttagttatgaatatgtaatatgacaaattaattatagatatttgccaaactaagttaaacaagatgagagtctcatatcctccatca |
117 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10527296 |
atgcttacaaaattcagttatgaatatgtaatatgacaaattaattatagatatttgccaaactaagttaaacaagatgagagtctcatatcctccatca |
10527395 |
T |
|
| Q |
118 |
ctcagaggttcaaaccttggagaaaa |
143 |
Q |
| |
|
|||| ||||||||||||||||||||| |
|
|
| T |
10527396 |
ctcaaaggttcaaaccttggagaaaa |
10527421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 108
Target Start/End: Complemental strand, 4894325 - 4894245
Alignment:
| Q |
28 |
aatttagttatgaatatgtaatatgacaaattaattatagatatttgccaaactaagttaaacaagatgagagtctcatat |
108 |
Q |
| |
|
|||||| |||| ||||| ||| |||||| |||| |||||||||||||| |||| |||||| |||||| | ||||| |||| |
|
|
| T |
4894325 |
aatttaattataaatatataacatgacatattagttatagatatttgcacaacttagttaatcaagataaaagtctaatat |
4894245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 76
Target Start/End: Original strand, 31763099 - 31763147
Alignment:
| Q |
28 |
aatttagttatgaatatgtaatatgacaaattaattatagatatttgcc |
76 |
Q |
| |
|
||||||||||| ||||| |||||||||||| | ||||||||| |||||| |
|
|
| T |
31763099 |
aatttagttataaatatataatatgacaaaattattatagatgtttgcc |
31763147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University