View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14649_low_57 (Length: 242)
Name: NF14649_low_57
Description: NF14649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14649_low_57 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 53805211 - 53804989
Alignment:
| Q |
7 |
agaatgtagcaattctccgaaaatggaatctgtgaaaggtttttctgaaacagtgaaagagattcagattctatttgaaagggcatcggattcagggaat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53805211 |
agaatgtagcaattctccgaaaatggaatctgtgaaaggtttttctgaaacagtgaaagagattcagattctatttgaaagggcatcggattcagggaat |
53805112 |
T |
|
| Q |
107 |
gtgattttggaaatgctagacgttggaaaacttcgttaccattcaaaaattgaactcaatccaggtaagcaagcaagttgtacaatttaattagtcattc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53805111 |
gtgattttggaaatgctagacgttggaaaacttcgttaccattcaaaaattgaactcaatccaggtaagcaagcaagttgtacaatttaattagtcattg |
53805012 |
T |
|
| Q |
207 |
tttagtgttttcaattattaagt |
229 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
53805011 |
tttagtgttttcaattattaagt |
53804989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University