View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14649_low_58 (Length: 239)
Name: NF14649_low_58
Description: NF14649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14649_low_58 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 33441085 - 33441321
Alignment:
| Q |
1 |
cttgttataagatattttatttcaataacaccaacaatcttcacattaattgaaatagatacatctttctctttcatactctaccatcagagctnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33441085 |
cttgttataagatattttatttcaataacaccaacaatcttcacattaattgaaatagatatatctttctctttcatactctaccatcagagctgaaaaa |
33441184 |
T |
 |
| Q |
101 |
nnnt----ataaaatcaagaatatatatcaaaatttcctgttgcgaaaattagaccgggttgtgtgtatccctcatcggacttaacattaaaacgagcca |
196 |
Q |
| |
|
| |||||||||||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33441185 |
aaaataaaaaaaaatcaagaatatatgtcaaaatttcccgttgcaaaaattagaccgggttgtgtgtatccctcatcggacttaacattaaaacgagcca |
33441284 |
T |
 |
| Q |
197 |
atttttagattcaaactcgacccttgaccaatcaaac |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33441285 |
atttttagattcaaactcgacccttgaccaatcaaac |
33441321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University