View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14649_low_74 (Length: 222)
Name: NF14649_low_74
Description: NF14649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14649_low_74 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 18 - 203
Target Start/End: Original strand, 30959874 - 30960061
Alignment:
| Q |
18 |
tcattgtgatccaaattattcaactccgggcaatatgcatcatctcccctaaacatcatgttgnnnnnnnnn--ttcacaaattccttgaataaacaatc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30959874 |
tcattgtgatccaaattattcaactccgggcaatatgcatcatctcccctaaacatcatgttgaaagaaaaaaattcacaaattccttgaataaacaatc |
30959973 |
T |
|
| Q |
116 |
aaaatattagggttattgttcaaacacaaataattatagtgatgataaaacattggttgtgttgcaagtaaaattgtctttctcgctt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30959974 |
aaaatattagggttattgttcaaacacaaataattatagtgatgataaaacattggttgtgttgcaagtaaaattgtctttctcgctt |
30960061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University