View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1464_high_25 (Length: 244)
Name: NF1464_high_25
Description: NF1464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1464_high_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 19 - 234
Target Start/End: Complemental strand, 7150300 - 7150086
Alignment:
| Q |
19 |
caaaccgccgtggctttaacttataaccgccgcaaatagtgttctttatggtgcatagaatcatagtcgtaatggaagagcannnnnnnnaccaaattaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
7150300 |
caaaccgccgtggctttaacttataacctccgcaaatagtgttctttatggtgcagagaatcatagtcgtaatggaagagcattttttttaccaa-ttaa |
7150202 |
T |
|
| Q |
119 |
tggaatcgcataatgcttcattattttgatactttgtaaactaatagaataaaatggaaaatgatagcatctttactagtacaatgaaaaacatctcgaa |
218 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7150201 |
tggaatcgcataatgctccattattttgatactttgtaaactaatagaataaaatggaaaatgatagcatctttactagtacaatgaaaaacatctcgaa |
7150102 |
T |
|
| Q |
219 |
tagaatgcggcctttg |
234 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
7150101 |
tagaatgcggcctttg |
7150086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University