View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1464_high_28 (Length: 232)

Name: NF1464_high_28
Description: NF1464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1464_high_28
NF1464_high_28
[»] chr1 (1 HSPs)
chr1 (1-182)||(23522857-23523038)


Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 23523038 - 23522857
Alignment:
1 atgctgttgttgatgatgatgatggtagagatgtggatcagagaaagtagtagcatgtaccatagttgattgaaggtgttgtcgttttgcgtgttgacgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23523038 atgctgttgttgatgatgatgatggtagagatgtggatcagagaaagtagtagcatgtaccatagttgattgaaggtgttgtcgttttgcgtgttgacgt 23522939  T
101 tctcttttgtgtgcgttttgatgaccacctaaggcttgtgaagtaggaaagtttctacaacagtaatgacattcaaatcttc 182  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23522938 tctcttttgtgtgcgttttgatgaccacctaaggcttgtgaagtaggaaagtttctacaacagtaatgacattcaaatcttc 23522857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University