View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1464_low_19 (Length: 347)
Name: NF1464_low_19
Description: NF1464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1464_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 5e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 136 - 333
Target Start/End: Complemental strand, 16398237 - 16398038
Alignment:
| Q |
136 |
aggtgcctttatcgcaaaactccagcaaaacacaaagttcataataattaaaattagcaagcacgcacataatactaagttctatggagactgttcctaa |
235 |
Q |
| |
|
|||||| |||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| ||| |
|
|
| T |
16398237 |
aggtgcttttatcccaacactccagcaaaacacaaagttcataataattaaaattagcaagcaggcacataatagcaagttctatggagactgttcttaa |
16398138 |
T |
 |
| Q |
236 |
acaacacaaaataaaaccctagtagagaacaattctgaaataca--gtgtcattgttcccaacaccaggtgcaccaaccatgacatggcaaccatctctg |
333 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16398137 |
acaacacaaaataaaaccctagtagcgaacaattctgaaatacagtgtgtcattgctcccaacaccaggtgcaccaaccatgacatggcaaccatctctg |
16398038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University