View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1464_low_24 (Length: 291)
Name: NF1464_low_24
Description: NF1464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1464_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 1 - 275
Target Start/End: Original strand, 31046949 - 31047223
Alignment:
| Q |
1 |
aaaaatgcacgtaaatagagattcactatactaacgacgtcgttttcaattttgcgttttcggttttccgcatacatcaacttcacgtattcgttcaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31046949 |
aaaaatgcacgtaaatagagattcactatactaacgacgtcgttttcaattttgcgttttcggttttccgcatacatcaacttcacgtatttgttcaaaa |
31047048 |
T |
 |
| Q |
101 |
acttcaaatcaacatcacgaaatttcaattcctaaaagctaaacacaacatgcaaaaatcaatcgattttacagatctaaatcaaaatcaataatcacac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31047049 |
acttcaaatcaacatcacgaaatttcaattccaaaaagctaaacacaacatgcaaaaatcaatcgattttacagatctaaatcaaaatcaataatcacac |
31047148 |
T |
 |
| Q |
201 |
aacagcactaacatacaaaattcaagaaaagagcgagaaaactaacctgaacgatgcgaattttcaccaagtgtt |
275 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31047149 |
aacaacactaacatacaaaattcaagaaaagagcgagaaaactaacctgaacgatgcgaattttcaccaagtgtt |
31047223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University