View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1464_low_27 (Length: 264)
Name: NF1464_low_27
Description: NF1464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1464_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 16 - 249
Target Start/End: Complemental strand, 29251949 - 29251716
Alignment:
| Q |
16 |
caattctccctctcattgtctatattccaatgtgtccttttcttcatcacctcttacaaaggttcaccaacttcacattcttcaacctcacttgcttctg |
115 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29251949 |
caattctccctctcattgtttatattccaatgtgtccttttcttcatcacctctcacaaaggttcaccaacttcacattcttcaacctcacttgcttctg |
29251850 |
T |
|
| Q |
116 |
cggtgacctaaacacgtctctctccctcaaaaatttcttgattcctgttgaacctcacattgctctgtctctcctaccaacccaccatttctgcaaatgt |
215 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29251849 |
cggtgacctaaatacgtctctctccctcaaaaatttcttgatttctgttgaacctcacattgctctatctctcctaccaacccaccatttctgcaaatgt |
29251750 |
T |
|
| Q |
216 |
gtttggagctttcttcttaaatattaaacctttg |
249 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||| |
|
|
| T |
29251749 |
gtttcgagctttcttcttgaatattaaacctttg |
29251716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University