View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1464_low_32 (Length: 242)
Name: NF1464_low_32
Description: NF1464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1464_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 14 - 228
Target Start/End: Complemental strand, 24911483 - 24911267
Alignment:
| Q |
14 |
tactgatatccctatcttccacagtagatacttaaatcctaatgaaaccaaattttttgatgttcaactctcagcaatggaattaggacaatctacattt |
113 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24911483 |
tactgatatccctgtcttctacagtagatacttaaatcctaatgaaaccaaaatttttgatgttcaactctcagcaatggaattaggacaatctacattt |
24911384 |
T |
 |
| Q |
114 |
gttaagttcactaaacttattctttaaactttaaaaaattacgagtcaattgttttaca--ttttgactatatctcgaaattttgcagatcttaagttca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |||||||||||| |||| |||| |
|
|
| T |
24911383 |
gttaagttcactaaacttattctttaaactttaaaaaattaccagtcaattgttttacattttttgactatatctcagaattttgcagattttaacttca |
24911284 |
T |
 |
| Q |
212 |
atattaggcatgtatct |
228 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
24911283 |
taattgggcatgtatct |
24911267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University