View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1464_low_33 (Length: 239)
Name: NF1464_low_33
Description: NF1464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1464_low_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 16398440 - 16398664
Alignment:
| Q |
1 |
atcagaatttttatcatttgttgttgtttatactttagcaatgagatagtctcctatgtttgctttcaaaatgattttggaccataatcatttcaatcat |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16398440 |
atcagaatttttatcatttggtgttgtttatactttagcaatgagatagtctcctatgtttgctttcaagatgattttggaccataatcatttcaatcat |
16398539 |
T |
 |
| Q |
101 |
atgatattgatcatggttatacttgaaagtttccttgagcttaggatttgcagaactatttgacagtgcatactagccgatatgtgttttatgttaacta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
16398540 |
atgatattgatcatggttatacttgaaagtttccttgagcttatgatttgcagaactatttgacaatgcatactagccgatatgtgttttatgttaacta |
16398639 |
T |
 |
| Q |
201 |
tggtctacgtatatgagaagtatat |
225 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
16398640 |
cggtctacgtatatgagaagtatat |
16398664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 223
Target Start/End: Original strand, 21124831 - 21124885
Alignment:
| Q |
169 |
catactagccgatatgtgttttatgttaactatggtctacgtatatgagaagtat |
223 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21124831 |
catactagctgttatgtgttttatgttaactatggtctacgtatatgaggagtat |
21124885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 216
Target Start/End: Complemental strand, 1672725 - 1672678
Alignment:
| Q |
169 |
catactagccgatatgtgttttatgttaactatggtctacgtatatga |
216 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1672725 |
catactagctgttatgtgttttatgttaactatggtgtacgtatatga |
1672678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University