View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1464_low_38 (Length: 211)
Name: NF1464_low_38
Description: NF1464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1464_low_38 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 77; Significance: 6e-36; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 12894253 - 12894161
Alignment:
| Q |
1 |
aatatctttggcttgtttggtcaactgatcttcaagaccttgaccatgaaaccaaagtctgaaggcaccagcccatatgttgtagttggctgt |
93 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12894253 |
aatatctttggcttgtttggtcaagtgatcttcaagaccttgaccgtgaaaccagagtctgacggcaccagcccatatgttgtagttggctgt |
12894161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University