View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1464_low_9 (Length: 446)
Name: NF1464_low_9
Description: NF1464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1464_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 70; Significance: 2e-31; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 358 - 431
Target Start/End: Complemental strand, 10612829 - 10612756
Alignment:
| Q |
358 |
aatactgaaaactcacttctcaatacctttctctctgtttcaaactctaagctatgataatatataaagaattt |
431 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10612829 |
aatactgaaaactcacttctcaatacctttctctctgcttcaaactctaagctatgataatatataaagaattt |
10612756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 147 - 199
Target Start/End: Original strand, 37972686 - 37972738
Alignment:
| Q |
147 |
tgagttcatgagttgtgtgagcctattaacgaacaatataaagtgttgtcaca |
199 |
Q |
| |
|
||||||||||||||| |||| || |||||| ||||||||| ||||| |||||| |
|
|
| T |
37972686 |
tgagttcatgagttgcgtgatcccattaacaaacaatatatagtgtagtcaca |
37972738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University