View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14650_low_3 (Length: 258)
Name: NF14650_low_3
Description: NF14650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14650_low_3 |
 | |
|
| [»] scaffold0155 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0155 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: scaffold0155
Description:
Target: scaffold0155; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 250
Target Start/End: Complemental strand, 26019 - 25787
Alignment:
| Q |
18 |
caaagaaatgttacggtaagaaactattatactcattgtgcaatagatttcgatggcgatgatagcattcgcggtaggcttttgggtgcgaaaatagatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26019 |
caaagaaatgttacggtaagaaactattatactcgttgtgcaatagatttcgatggcgatgatagcattcgcggtaggcttttgggtgcgaaaatagatt |
25920 |
T |
|
| Q |
118 |
tggagctcaaaaattatccagacatggcttcacaaataggttttgttatgcaacacattgatgattgtattgatagtctgcataaaaatgatatatgccc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25919 |
tggagctcaaaaattatccagacatggcttcacaaataggttttgttatgcaacacattgatgattgtattgatagtctgcataaaaatgatactagccc |
25820 |
T |
|
| Q |
218 |
aatactcgcaaaagatgttgatattcttcgaca |
250 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||| |
|
|
| T |
25819 |
aatacttgcaaaggatgttgatattcttcgaca |
25787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University