View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14651_high_5 (Length: 257)
Name: NF14651_high_5
Description: NF14651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14651_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 139 - 250
Target Start/End: Complemental strand, 32801987 - 32801876
Alignment:
| Q |
139 |
attaaccacaaaaattaaaggagaataaaacttcgttttctattttggtaaagtatattataatgtaaaaaattgatgagataatgtaagagttgtttta |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
32801987 |
attaaccacaaaaattaaaggagaataaaacttcgttttctattttggtaaagtatattataatgtaaaaaattgatgagatgatgtaagagttgcttta |
32801888 |
T |
 |
| Q |
239 |
ggtagctatttt |
250 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32801887 |
ggtagctatttt |
32801876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University