View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14651_low_6 (Length: 292)
Name: NF14651_low_6
Description: NF14651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14651_low_6 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 76 - 292
Target Start/End: Complemental strand, 45928708 - 45928492
Alignment:
| Q |
76 |
ttggggcagtgctgatgcataatagacagcatattgcatattacagctaggccttatccgaagtaaatttggtgagagaggtgtaagaggatcatcttag |
175 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45928708 |
ttggggcggtgctgatgcataatagacagcctattgcatattacagctaggccttatccgaagtaaatttggtgagagaggtgtaagaggatcatcttag |
45928609 |
T |
|
| Q |
176 |
aattaatggctaggctagtagtatccttctactagatttggttttttctttctattatggtgtaacttcctccatttgtattctaataaagttccatcta |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45928608 |
aattaatggctaggctagtagtatccttctactagatttggttttttctttctattatggtgtaacttcctccatttgtattctaataaagttccatcta |
45928509 |
T |
|
| Q |
276 |
gttgattcacattctcc |
292 |
Q |
| |
|
|||||||| |||||||| |
|
|
| T |
45928508 |
gttgattctcattctcc |
45928492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 15 - 69
Target Start/End: Complemental strand, 45934253 - 45934199
Alignment:
| Q |
15 |
aacacagaggctaaatgcagttgcatgataatgaaatcacccaatgcagtccgaa |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45934253 |
aacacagaggctaaatgcagttgcatgataatgaaatcacccaaggcagtccgaa |
45934199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 15 - 69
Target Start/End: Complemental strand, 15816487 - 15816433
Alignment:
| Q |
15 |
aacacagaggctaaatgcagttgcatgataatgaaatcacccaatgcagtccgaa |
69 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
15816487 |
aacacagaggctaattgcagttgcatgataatgaaatcacccaaggcagtccgaa |
15816433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University