View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14653_low_3 (Length: 302)
Name: NF14653_low_3
Description: NF14653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14653_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 5e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 22 - 289
Target Start/End: Complemental strand, 8139216 - 8138948
Alignment:
| Q |
22 |
actgcccccttgccctctgcatatgatatcattacacacttaaaatcatataaaacatatttgaaaaattaaactagctaagaaattttgataagaaaaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8139216 |
actgcccccttgccctctgcatatgatatcattacacacttaaaatcatataaaacatatttgaaaaattaaactacctaagaaattttgataagaaaaa |
8139117 |
T |
 |
| Q |
122 |
taatgaaatttatctgtcacttattttcaagagatttaaggataatttcannnnnnnaggtacaaattatgtaatttaacattatactaggagtagtcaa |
221 |
Q |
| |
|
||||||||||| |||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8139116 |
taatgaaatttgcctgtcacttagtgacaagagatttaaggataatttcatttttttaggtacaaattatgtaatttaacattatactaggagtagtcaa |
8139017 |
T |
 |
| Q |
222 |
nnnnnnnnnnnnnacaagaattatgaattgtcaattatatctttg-ttatcttacttgggaatattctt |
289 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
8139016 |
tttttgtttttttacaagaattatgaattgtcaattatatatttgtttatcttacttgggaatattctt |
8138948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 22 - 62
Target Start/End: Complemental strand, 8163329 - 8163289
Alignment:
| Q |
22 |
actgcccccttgccctctgcatatgatatcattacacactt |
62 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8163329 |
actgctcccttgccctctgcatatgatatcattgcacactt |
8163289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University