View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14654_low_15 (Length: 239)
Name: NF14654_low_15
Description: NF14654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14654_low_15 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 71 - 239
Target Start/End: Original strand, 38791722 - 38791890
Alignment:
| Q |
71 |
cttgatagtcaccatatataatacaaagattgtctctagtcatacttatatgatacctttcatcattagttagaattttatcatgaaagatattaatgtt |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
38791722 |
cttgatagtcaccatatataatacaaagattgtctctagtcatacttatatgatacctttcatcattagttagaattttaccatgaaagatattaaggtt |
38791821 |
T |
|
| Q |
171 |
tgttgagaagaagtgatgtttaccatgtatgatagaatacggtgatttgagagagaaatctccatctct |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38791822 |
tgttgagaagaagtgatgtttaccatgtatgatagaatacggtgatttgagagagaaatctccatctct |
38791890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 75
Target Start/End: Original strand, 38791320 - 38791376
Alignment:
| Q |
19 |
attcaccaatattaaacttataatgatcgtctggtagagatgaccaaaagaccttga |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38791320 |
attcaccaatattaaacttataatgatcgtctggtagagatgaccaaaagaccttga |
38791376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University