View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14654_low_17 (Length: 218)
Name: NF14654_low_17
Description: NF14654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14654_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 28 - 87
Target Start/End: Complemental strand, 47776667 - 47776608
Alignment:
| Q |
28 |
ttgagatcagaagtgaaagtgtgtgatttgggttggtttttaaggtgttttgattatgcg |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47776667 |
ttgagatcagaagtgaaagtgtgtgatttgggttggtttttagggtgttttgattatgcg |
47776608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 82
Target Start/End: Original strand, 29220892 - 29220944
Alignment:
| Q |
28 |
ttgagatcagaagtgaaagtgtgtgatttgggttggtttttaaggtgttttgatt |
82 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||| |||||||||||| |
|
|
| T |
29220892 |
ttgagatcagaagtgaaagtgt--gatttgggtttgtttttagggtgttttgatt |
29220944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University